Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA 3.2/V5-DEST NET1A S46A
(Plasmid #69818)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69818 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA 3.2/V5-DEST
  • Backbone size w/o insert (bp) 5394
  • Total vector size (bp) 7122
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neuroepithelial cell-transforming gene 1 protein A
  • Alt name
    NET1A (short isoform of NET1), ARHGEF8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1728
  • Mutation
    S46A
  • Entrez Gene
    NET1 (a.k.a. ARHGEF8, NET1A)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
  • 3′ sequencing primer GTCTCCTTCCGTGTTTCAGTTAGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector is Gateway and cDNA is from Orfeome library (Open Biosystems)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.2/V5-DEST NET1A S46A was a gift from Anne Brunet (Addgene plasmid # 69818 ; http://n2t.net/addgene:69818 ; RRID:Addgene_69818)
  • For your References section:

    Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction. Schaffer BE, Levin RS, Hertz NT, Maures TJ, Schoof ML, Hollstein PE, Benayoun BA, Banko MR, Shaw RJ, Shokat KM, Brunet A. Cell Metab. 2015 Nov 3;22(5):907-21. doi: 10.1016/j.cmet.2015.09.009. Epub 2015 Oct 8. 10.1016/j.cmet.2015.09.009 PubMed 26456332