Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69838)


Item Catalog # Description Quantity Price (USD)
Plasmid 69838 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4794
  • Total vector size (bp) 7704
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    PLK4 (a.k.a. MCCRP2, SAK, STK18)
  • Promoter CMV
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • 3xFLAG tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer GFP 3' Fw (TTCGTGACCGCCGCCGGGATCA)
  • (Common Sequencing Primers)

Terms and Licenses

Depositor Comments

PLK4 contains E830D compared to listed reference sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C3-PLK4 K41M-3xFLAG was a gift from Michel Bornens (Addgene plasmid # 69838 ; ; RRID:Addgene_69838)
  • For your References section:

    Autophosphorylation of polo-like kinase 4 and its role in centriole duplication. Sillibourne JE, Tack F, Vloemans N, Boeckx A, Thambirajah S, Bonnet P, Ramaekers FC, Bornens M, Grand-Perret T. Mol Biol Cell. 2010 Feb 15;21(4):547-61. doi: 10.1091/mbc.E09-06-0505. Epub 2009 Dec 23. 10.1091/mbc.e09-06-0505 PubMed 20032307