pTL370
(Plasmid
#69880)
-
PurposeattB flanked genomic Cirl for integration at attP sites.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGE-attB-GMR
-
Backbone manufacturerHuang et al., 2009, PMID 19429710
- Total vector size (bp) 16880
-
Vector typephiC31-integration vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCIRL
-
SpeciesD. melanogaster (fly)
-
Entrez GeneCirl (a.k.a. Dmel_CG8639, BcDNA:GH07331, CG8639, CIRL, Dmel\CG8639, anon-WO0170980.7, anon-WO0170980.8, dcirl)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer pCasper-R GTCGGCAAGAGACATCCACT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTL370 was a gift from Robert Kittel & Tobias Langenhan (Addgene plasmid # 69880 ; http://n2t.net/addgene:69880 ; RRID:Addgene_69880) -
For your References section:
The adhesion GPCR latrophilin/CIRL shapes mechanosensation. Scholz N, Gehring J, Guan C, Ljaschenko D, Fischer R, Lakshmanan V, Kittel RJ, Langenhan T. Cell Rep. 2015 May 12;11(6):866-74. doi: 10.1016/j.celrep.2015.04.008. Epub 2015 Apr 30. 10.1016/j.celrep.2015.04.008 PubMed 25937282