Skip to main content

pTL370
(Plasmid #69880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69880 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGE-attB-GMR
  • Backbone manufacturer
    Huang et al., 2009, PMID 19429710
  • Total vector size (bp) 16880
  • Vector type
    phiC31-integration vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CIRL
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    Cirl (a.k.a. Dmel_CG8639, BcDNA:GH07331, CG8639, CIRL, Dmel\CG8639, anon-WO0170980.7, anon-WO0170980.8, dcirl)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer pCasper-R GTCGGCAAGAGACATCCACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTL370 was a gift from Robert Kittel & Tobias Langenhan (Addgene plasmid # 69880 ; http://n2t.net/addgene:69880 ; RRID:Addgene_69880)
  • For your References section:

    The adhesion GPCR latrophilin/CIRL shapes mechanosensation. Scholz N, Gehring J, Guan C, Ljaschenko D, Fischer R, Lakshmanan V, Kittel RJ, Langenhan T. Cell Rep. 2015 May 12;11(6):866-74. doi: 10.1016/j.celrep.2015.04.008. Epub 2015 Apr 30. 10.1016/j.celrep.2015.04.008 PubMed 25937282