pTL464
(Plasmid
#69881)
-
Purposea dCirl transcriptional reporter allele that contains an optimized gal4.2::p65 cassette at the start codon of the genomic dCirl ORF
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69881 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGE-attB-GMR
-
Backbone manufacturerHuang et al., 2009, PMID 19429710
- Total vector size (bp) 18440
-
Modifications to backboneGal4-2::p65d fragment inserted into start region of the dCirl locus
-
Vector typephiC31-integration vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCIRL
-
SpeciesD. melanogaster (fly)
-
Entrez GeneCirl (a.k.a. Dmel_CG8639, BcDNA:GH07331, CG8639, CIRL, Dmel\CG8639, anon-WO0170980.7, anon-WO0170980.8, dcirl)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCasper-R GTCGGCAAGAGACATCCACT
- 3′ sequencing primer pBluescript-SK (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTL464 was a gift from Robert Kittel & Tobias Langenhan (Addgene plasmid # 69881 ; http://n2t.net/addgene:69881 ; RRID:Addgene_69881) -
For your References section:
The adhesion GPCR latrophilin/CIRL shapes mechanosensation. Scholz N, Gehring J, Guan C, Ljaschenko D, Fischer R, Lakshmanan V, Kittel RJ, Langenhan T. Cell Rep. 2015 May 12;11(6):866-74. doi: 10.1016/j.celrep.2015.04.008. Epub 2015 Apr 30. 10.1016/j.celrep.2015.04.008 PubMed 25937282