Hy_pMT Laccase2 MCS-Laccase2 608-1097
(Plasmid
#69890)
-
PurposeExpresses the Drosophila laccase2 exon 2 circular RNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneHy_pMT Laccase2 MCS Exon Vector
- Backbone size w/o insert (bp) 8622
- Total vector size (bp) 9112
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLaccase2
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)490
-
MutationL158I in laccase2
-
Entrez Genestw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
- Promoter Metallothionein Promoter (pMT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT Laccase2 MCS-Laccase2 608-1097 was a gift from Jeremy Wilusz (Addgene plasmid # 69890 ; http://n2t.net/addgene:69890 ; RRID:Addgene_69890) -
For your References section:
Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910