Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1(+) ZKSCAN1 MCS-HIPK3 Exon
(Plasmid #69905)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69905 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+) ZKSCAN1 MCS Exon Vector
  • Backbone size w/o insert (bp) 6705
  • Total vector size (bp) 7765
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HIPK3
  • Alt name
    Homeodomain Interacting Protein Kinase 3
  • Species
    H. sapiens (human), D. melanogaster (fly)
  • Insert Size (bp)
    1099
  • Mutation
    Expresses aa1-194 of HIPK3
  • Entrez Gene
    HIPK3 (a.k.a. DYRK6, FIST3, PKY, YAK1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+) ZKSCAN1 MCS-HIPK3 Exon was a gift from Jeremy Wilusz (Addgene plasmid # 69905 ; http://n2t.net/addgene:69905 ; RRID:Addgene_69905)
  • For your References section:

    Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910