pT7_circRAJ31
(Plasmid
#69931)
-
PurposeExpresses RAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator. Under control of a T7 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69931 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufacturerRegistry of Standard Biological Parts
- Backbone size w/o insert (bp) 2491
- Total vector size (bp) 2040
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepT7_circRAJ31
-
SpeciesSynthetic
-
Insert Size (bp)451
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Engineering a circular riboregulator in Escherichia coli - Rostain et al.
Please check Genbank file for complete annotation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7_circRAJ31 was a gift from Alfonso Jaramillo (Addgene plasmid # 69931 ; http://n2t.net/addgene:69931 ; RRID:Addgene_69931) -
For your References section:
Engineering a Circular Riboregulator in Escherichia coli. Rostain W, Shen S, Cordero T, Rodrigo G, Jaramillo A. Biodes Res. 2020 Sep 12;2020:1916789. doi: 10.34133/2020/1916789. eCollection 2020. 10.34133/2020/1916789 PubMed 37849901