AL562-2
(Plasmid
#69937)
-
PurposeConstruct targeting the PIE-target sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufacturerRegistry of Standard Biological Parts
- Backbone size w/o insert (bp) 2058
- Total vector size (bp) 2268
-
Modifications to backboneAddition of BsaI restriction enzymes
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAL562-2
-
SpeciesSynthetic
-
Insert Size (bp)210
- Promoter TAATACGACTCACTATAGGG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer tgccacctgacgtctaagaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see genebank file for annotations.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AL562-2 was a gift from Alfonso Jaramillo (Addgene plasmid # 69937 ; http://n2t.net/addgene:69937 ; RRID:Addgene_69937) -
For your References section:
Design and Characterization of Topological Small RNAs. Hassall J, MacDonald P, Cordero T, Rostain W, Jaramillo A. Methods Mol Biol. 2015;1316:149-67. doi: 10.1007/978-1-4939-2730-2_13. 10.1007/978-1-4939-2730-2_13 PubMed 25967060