Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSCKtheoRaj12-o11
(Plasmid #69941)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69941 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSTC2
  • Backbone size w/o insert (bp) 3376
  • Total vector size (bp) 4524
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TheoHHAzRaj12,cisRaj11,sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1148

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer gctcactcaaaggcggtaat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please check Genbank file for complete sequence annotation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCKtheoRaj12-o11 was a gift from Alfonso Jaramillo (Addgene plasmid # 69941 ; http://n2t.net/addgene:69941 ; RRID:Addgene_69941)
  • For your References section:

    Dynamic signal processing by ribozyme-mediated RNA circuits to control gene expression. Shen S, Rodrigo G, Prakash S, Majer E, Landrain TE, Kirov B, Daros JA, Jaramillo A. Nucleic Acids Res. 2015 May 26;43(10):5158-70. doi: 10.1093/nar/gkv287. Epub 2015 Apr 27. 10.1093/nar/gkv287 PubMed 25916845