pDS3-X4
(Plasmid
#70140)
-
PurposeYeast chr. integration vector with DS3 selection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCfB395
- Total vector size (bp) 6900
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDS3
-
Insert Size (bp)1300
- Promoter AgTEF1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTTGCTAGGATACAGTTCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS3-X4 was a gift from Morten Sommer (Addgene plasmid # 70140 ; http://n2t.net/addgene:70140 ; RRID:Addgene_70140) -
For your References section:
Flexible metabolic pathway construction using modular and divisible selection gene regulators. Rugbjerg P, Myling-Petersen N, Sommer MO. Metab Eng. 2015 Sep;31:189-97. doi: 10.1016/j.ymben.2015.08.004. Epub 2015 Aug 21. 10.1016/j.ymben.2015.08.004 PubMed 26303342