pDS2-aurZ
(Plasmid
#70151)
-
PurposeFusarium graminearum AurZ encoded on CEN/ARS yeast shuttle vector with DS2 selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDS2
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6200
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaurZ
-
SpeciesFusarium graminearum
-
Insert Size (bp)1250
- Promoter Tef
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTCTTGCTCATTAGAAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS2-aurZ was a gift from Morten Sommer (Addgene plasmid # 70151 ; http://n2t.net/addgene:70151 ; RRID:Addgene_70151) -
For your References section:
Flexible metabolic pathway construction using modular and divisible selection gene regulators. Rugbjerg P, Myling-Petersen N, Sommer MO. Metab Eng. 2015 Sep;31:189-97. doi: 10.1016/j.ymben.2015.08.004. Epub 2015 Aug 21. 10.1016/j.ymben.2015.08.004 PubMed 26303342