pDS3-aurJ
(Plasmid
#70152)
-
PurposeFusarium graminearum AurJ encoded on CEN/ARS yeast shuttle vector with DS3 selection marker
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDS3
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 6700
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaurJ
-
SpeciesFusarium graminearum
-
Insert Size (bp)2350
-
GenBank ID
- Promoter GPD1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACGGTAGGTATTGATTGTAATTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS3-aurJ was a gift from Morten Sommer (Addgene plasmid # 70152 ; http://n2t.net/addgene:70152 ; RRID:Addgene_70152) -
For your References section:
Flexible metabolic pathway construction using modular and divisible selection gene regulators. Rugbjerg P, Myling-Petersen N, Sommer MO. Metab Eng. 2015 Sep;31:189-97. doi: 10.1016/j.ymben.2015.08.004. Epub 2015 Aug 21. 10.1016/j.ymben.2015.08.004 PubMed 26303342
Map uploaded by the depositor.