Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

OPA1-isoform5
(Plasmid #70177)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70177 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV-puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hsOPA1 isoform 5
  • Alt name
    Optic atrophy 1 protein
  • Alt name
    KIAA0567
  • Alt name
    DYNAMIN-LIKE 120-KD PROTEIN, MITOCHONDRIAL
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    OPA1 (a.k.a. BERHS, MGM1, MTDPS14, NPG, NTG, largeG)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HpaI (destroyed during cloning)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compared to GenBank reference sequence NM_130834.2, the OPA1 isoform in this plasmid contains a S158N polymorphism/SNP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OPA1-isoform5 was a gift from David Chan (Addgene plasmid # 70177 ; http://n2t.net/addgene:70177 ; RRID:Addgene_70177)
  • For your References section:

    OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. Song Z, Chen H, Fiket M, Alexander C, Chan DC. J Cell Biol. 2007 Aug 27;178(5):749-55. Epub 2007 Aug 20. 10.1083/jcb.200704110 PubMed 17709429