-
PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Eomes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-tetO
-
Backbone manufacturerHochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
- Backbone size w/o insert (bp) 8370
- Total vector size (bp) 10467
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEomes
-
Alt nameeomesodermin homolog (Xenopus laevis)
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001164789
-
Entrez GeneEomes (a.k.a. TBR-2, Tbr2)
- Promoter tetO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA sequence of Eomes was amplified from pCAG-EomesoER-IP (Niwa et al., 2005), kindly provided by H. Niwa (RIKEN Center for Developmental Biology), substituting the ER with a stop-codon and sub-cloned into the pLV-tetO vector via the EcoRI site.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-tetO-Eomes was a gift from Hubert Schorle (Addgene plasmid # 70271 ; http://n2t.net/addgene:70271 ; RRID:Addgene_70271) -
For your References section:
Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560