Skip to main content

pLV-tetO-Ascl2
(Plasmid #71151)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71151 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-tetO
  • Backbone manufacturer
    Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
  • Backbone size w/o insert (bp) 8370
  • Total vector size (bp) 9223
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ascl2
  • Alt name
    achaete-scute complex homolog 2 (Drosophila)
  • Alt name
    2410083I15Rik, bHLHa45, Mash2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    848
  • GenBank ID
    NM_008554
  • Entrez Gene
    Ascl2 (a.k.a. 2410083I15Rik, Mash2, bHLHa45)
  • Promoter tetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The cDNA sequence of murine Ascl2 was amplified and subcloned into the pCR2.1 vector. From there it was excised via flanking EcoRI sites and inserted into the pLV-tetO vector via the EcoRI. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-tetO-Ascl2 was a gift from Hubert Schorle (Addgene plasmid # 71151 ; http://n2t.net/addgene:71151 ; RRID:Addgene_71151)
  • For your References section:

    Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560