pJBL002
(Plasmid
#71202)
-
Purpose(Empty Backbone) Antisense Control Plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustom
-
Backbone manufacturerN/A
- Backbone size (bp) 2487
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter BBa_J23119
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- 3′ sequencing primer ttaccgcctttgagtgagctgataccgctcgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL002 was a gift from Julius Lucks (Addgene plasmid # 71202 ; http://n2t.net/addgene:71202 ; RRID:Addgene_71202) -
For your References section:
Creating small transcription activating RNAs. Chappell J, Takahashi MK, Lucks JB. Nat Chem Biol. 2015 Mar;11(3):214-20. doi: 10.1038/nchembio.1737. Epub 2015 Feb 2. 10.1038/nchembio.1737 PubMed 25643173