pAP1-3
(Plasmid #71258)

• Purpose: luciferase reporter with 3 copies of the stromelylisin gene AP-1 site in front of hGM-CSF -55 to +28 minimal promoter
• Depositing Lab: Peter Cockerill
• Depositing Organization: Royal Adelaide Hospital
  Located in Australia
• Publication: Development of receptor and oncogene-responsive luciferase reporter vectors that are activated via kinase signalling to AP-1. (unpublished)
• Citations: 1 Article

Backbone

• Vector backbone: pGM55
• Backbone manufacturer: Cockerill lab, Addgene plasmid 71249
• Total vector size (bp): 6305
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 copies of an AP-1 site from the human Stromelysin-1 gene
• Alt name: matrix metallopeptidase 3
• Species: H. sapiens (human)
• Entrez Gene: MMP3 (a.k.a. CHDS6, MMP-3, SL-1, STMY, STMY1, STR1)
• Promoter: GM-CSF minimal
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: LucNRev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned as 3 copies of an oligonucleotide duplex with complementary overhanging BglII ends: AGATCTGGATCACCCGCAGCTTGACTCATCCTTGCAGATCT

Reference for AP-1 site = Cockerill PN, Shannon MF, Bert AG, Ryan GR and Vadas MA. The GM-CSF/IL3 locus is regulated by an inducible cyclosporin A sensitive enhancer. Proc.Natl.Acad.Sci. USA 90, 2466-2470, 1993.

JM109 are the cells used by the author for pXPG and its derivatives.

DNA (Catalog # 71258-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 71258-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.