Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGC461
(Plasmid #71363)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJK590
  • Backbone manufacturer
    Blelloch et al., 1999; Mathies et al., 2003
  • Total vector size (bp) 9483
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    daf-16
  • Species
    C. elegans (nematode)
  • Entrez Gene
    daf-16 (a.k.a. CELE_R13H8.1)
  • Promoter Blelloch et al., 1999; Mathies et al., 2003
  • Tag / Fusion Protein
    • GFP(65C) (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer unknown
  • 3′ sequencing primer GFP-R (CCATCTAATTCAACAAGAATTGGGACAAC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    daf-16::GFP fusion was a gift of T. Johnson

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGC461 was a gift from Jane Hubbard (Addgene plasmid # 71363 ; http://n2t.net/addgene:71363 ; RRID:Addgene_71363)
  • For your References section:

    Insulin signaling promotes germline proliferation in C. elegans. Michaelson D, Korta DZ, Capua Y, Hubbard EJ. Development. 2010 Feb;137(4):671-80. doi: 10.1242/dev.042523. 10.1242/dev.042523 PubMed 20110332