pPRIME-dsRed-shscramble
(Plasmid
#71384)
-
PurposeExpresses dsRed and scramble shRNA under the control of the CMV promoter in eukaryotic cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Total vector size (bp) 8564
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlasmid has both Ampicllin and Chloramphenicol resistance, but you only need to grow it in Ampicillin; no need to use Chloramphenicol as well
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCMV promoter-dsRed-mir30-shscramble
-
SpeciesSynthetic; Discosoma coral
-
Insert Size (bp)4000
- Promoter CMV enhancer/promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATCAACGTCTCATTTTCGCCAAAAGTT
- 3′ sequencing primer GAAGTGATCTTCCGTCACAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythis plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-scramble
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPRIME-dsRed-shscramble was a gift from William Wisden (Addgene plasmid # 71384 ; http://n2t.net/addgene:71384 ; RRID:Addgene_71384) -
For your References section:
Wakefulness Is Governed by GABA and Histamine Cotransmission. Yu X, Ye Z, Houston CM, Zecharia AY, Ma Y, Zhang Z, Uygun DS, Parker S, Vyssotski AL, Yustos R, Franks NP, Brickley SG, Wisden W. Neuron. 2015 Jun 17. pii: S0896-6273(15)00516-4. doi: 10.1016/j.neuron.2015.06.003. 10.1016/j.neuron.2015.06.003 PubMed 26094607