Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPRIME-dsRed-shvgat
(Plasmid #71385)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71385 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC
  • Total vector size (bp) 8564
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Plasmid has both Ampicllin and Chloramphenicol resistance, but you only need to grow it in Ampicillin; no need to use Chloramphenicol as well
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMV promoter-dsRed-mir30-shvgat
  • Species
    Synthetic; Discosoma coral
  • Insert Size (bp)
    4000
  • Promoter CMV enhancer/promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGGACTCCTCCGAGGACG
  • 3′ sequencing primer GAAGTGATCTTCCGTCACAGG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-shvgat
  • Terms and Licenses

Depositor Comments

this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664) to make pPRIME-dsRed-shvgat

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRIME-dsRed-shvgat was a gift from William Wisden (Addgene plasmid # 71385 ; http://n2t.net/addgene:71385 ; RRID:Addgene_71385)
  • For your References section:

    Wakefulness Is Governed by GABA and Histamine Cotransmission. Yu X, Ye Z, Houston CM, Zecharia AY, Ma Y, Zhang Z, Uygun DS, Parker S, Vyssotski AL, Yustos R, Franks NP, Brickley SG, Wisden W. Neuron. 2015 Jun 17. pii: S0896-6273(15)00516-4. doi: 10.1016/j.neuron.2015.06.003. 10.1016/j.neuron.2015.06.003 PubMed 26094607