Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71454)


Item Catalog # Description Quantity Price (USD)
Plasmid 71454 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Andrei Gudkov lab
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    STAT1 (a.k.a. CANDF7, IMD31A, IMD31B, IMD31C, ISGF-3, STAT91)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGAGTTTGTTTTGGCACCA
  • 3′ sequencing primer CTCTTTCAGAGGTTATTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-WT-STAT1 was a gift from George Stark (Addgene plasmid # 71454 ; ; RRID:Addgene_71454)
  • For your References section:

    Unphosphorylated STAT1 prolongs the expression of interferon-induced immune regulatory genes. Cheon H, Stark GR. Proc Natl Acad Sci U S A. 2009 Jun 9;106(23):9373-8. doi: 10.1073/pnas.0903487106. Epub 2009 May 28. 10.1073/pnas.0903487106 PubMed 19478064