Skip to main content

pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02)
(Plasmid #71651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71651 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    paav-hSynI-hChR2(H134R)-mCherry-WPRE-hGH poly(A)
  • Backbone manufacturer
    Karl Deisseroth lab
  • Backbone size w/o insert (bp) 6221
  • Total vector size (bp) 5288
  • Modifications to backbone
    hChR2-mCherry portion was removed
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CATGGTGAGCAAGGGCG
  • 3′ sequencing primer CTTACTTGTACAGCTCGTCCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was found in lab's plasmid stock with information it was originally made by K. Diesseroth.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid made by Aleksandar Bajic. Expression tested in vitro on mouse primary neurons and human IPSCs derived neurons after infection with AAV viruses.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02) was a gift from Mirjana Maletić-Savatić (Addgene plasmid # 71651 ; http://n2t.net/addgene:71651 ; RRID:Addgene_71651)