pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02)
(Plasmid
#71651)
-
PurposeAAV expression of EGFP in human and mouse neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepaav-hSynI-hChR2(H134R)-mCherry-WPRE-hGH poly(A)
-
Backbone manufacturerKarl Deisseroth lab
- Backbone size w/o insert (bp) 6221
- Total vector size (bp) 5288
-
Modifications to backbonehChR2-mCherry portion was removed
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Insert Size (bp)720
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATGGTGAGCAAGGGCG
- 3′ sequencing primer CTTACTTGTACAGCTCGTCCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was found in lab's plasmid stock with information it was originally made by K. Diesseroth.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid made by Aleksandar Bajic. Expression tested in vitro on mouse primary neurons and human IPSCs derived neurons after infection with AAV viruses.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02) was a gift from Mirjana Maletić-Savatić (Addgene plasmid # 71651 ; http://n2t.net/addgene:71651 ; RRID:Addgene_71651)