Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC 3GLA UAS HAi
(Plasmid #71763)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71763 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    unknown
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pBR322ori-F (GGGAAACGCCTGGTATCTTT)
  • 3′ sequencing primer hsp70-R2 (CGACGTGTTCACTTTGCTTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the full plasmid sequence contains a few differences compared to GenBank ID: KM253740. These differences do not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC 3GLA UAS HAi was a gift from Matthias Soller (Addgene plasmid # 71763 ; http://n2t.net/addgene:71763 ; RRID:Addgene_71763)
  • For your References section:

    Plasmid-based gap-repair recombineered transgenes reveal a central role for introns in mutually exclusive alternative splicing in Down Syndrome Cell Adhesion Molecule exon 4. Haussmann IU, Ustaoglu P, Brauer U, Hemani Y, Dix TC, Soller M. Nucleic Acids Res. 2018 Dec 12. pii: 5239037. doi: 10.1093/nar/gky1254. 10.1093/nar/gky1254 PubMed 30541104