- 
            PurposeBrdU-incorporating plasmid with selectable marker LEU2
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71791 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRS405
- Backbone size w/o insert (bp) 5504
- Total vector size (bp) 11498
- 
              Vector typeYeast Expression
- 
                Selectable markersLEU2
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert 1
- 
                Gene/Insert nameThymidine Kinase
- 
                    SpeciesHerpers Simplex Virus
- 
                  Insert Size (bp)2100
- 
                    GenBank IDJ02224.1
- Promoter GPD
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer cgccagggttttcccagtcacgac (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert nameENT1
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1300
- 
                    GenBank IDAF079117.1
- 
                        Entrez GeneSLC29A1 (a.k.a. AUG, ENT1, hENT1)
- Promoter ADH1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer cgccagggttttcccagtcacgac
- 3′ sequencing primer agcggataacaatttcacacagg (Common Sequencing Primers)
Resource Information
- 
            
            
            Addgene Notes
- 
            A portion of this plasmid was derived from a plasmid made byHSV-TK from E. Schwob hENT1 from C. Cass
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: p405-BrdU-Inc was a gift from Oscar Aparicio (Addgene plasmid # 71791 ; http://n2t.net/addgene:71791 ; RRID:Addgene_71791)
- 
                For your References section: New vectors for simplified construction of BrdU-Incorporating strains of Saccharomyces cerevisiae. Viggiani CJ, Aparicio OM. Yeast. 2006 Oct-Nov;23(14-15):1045-51. 10.1002/yea.1406 PubMed 17083135
