-
PurposeExpresses high specificity SpCas9. Px330-like plasmid.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
| Cloning Grade DNA | 71814-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $110 | |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang lab (Addgene plasmid #42230)
- Total vector size (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced specificity Cas9 (1.1)
-
Alt nameeSpCas9(1.1)
-
SpeciesS. pyogenes
-
MutationK848A, K1003A, & R1060A
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Cloning Grade DNA (Catalog # 71814-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $110 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814 ; http://n2t.net/addgene:71814 ; RRID:Addgene_71814) -
For your References section:
Rationally engineered Cas9 nucleases with improved specificity. Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F. Science. 2015 Dec 1. pii: aad5227. 10.1126/science.aad5227 PubMed 26628643