pLJM60-FLAG-SLC38A9.1 Y71A
(Plasmid
#71865)
-
Purposelentiviral stable expression
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLJM60
- Backbone size w/o insert (bp) 8613
- Total vector size (bp) 10299
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSLC38A9.1
-
Alt nameURLC11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1686
-
Mutationcodon optimized, Tyrosine 71 mutated to Alanine
-
GenBank IDNM_173514.3
-
Entrez GeneSLC38A9 (a.k.a. URLC11)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer pLJM-F ATGTCGTAACAACTCCGCCCCATT
- 3′ sequencing primer pLJM-R TAGTTTGTATGTCTGTTGCTATTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM60-FLAG-SLC38A9.1 Y71A was a gift from David Sabatini (Addgene plasmid # 71865 ; http://n2t.net/addgene:71865 ; RRID:Addgene_71865) -
For your References section:
Metabolism. Lysosomal amino acid transporter SLC38A9 signals arginine sufficiency to mTORC1. Wang S, Tsun ZY, Wolfson RL, Shen K, Wyant GA, Plovanich ME, Yuan ED, Jones TD, Chantranupong L, Comb W, Wang T, Bar-Peled L, Zoncu R, Straub C, Kim C, Park J, Sabatini BL, Sabatini DM. Science. 2015 Jan 9;347(6218):188-94. doi: 10.1126/science.1257132. Epub 2015 Jan 7. 10.1126/science.1257132 PubMed 25567906