Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMIR-192-Reporter
(Plasmid #71872)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71872 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMIR-REPORT Luciferase
  • Backbone manufacturer
    Applied Biosystems
  • Backbone size w/o insert (bp) 6470
  • Total vector size (bp) 6497
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Reverse complementary sequence of miR-192
  • Alt name
    miR-192 binding sequence
  • gRNA/shRNA sequence
    TCTGACCTATGAATTGACAGCCA
  • Species
    H. sapiens (human)
  • Promoter CMV
  • Tag / Fusion Protein
    • firefly luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer Luc-F
  • 3′ sequencing primer pRS-marker
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human miR-192 binding site was generated by annealing of two oligos as described in the reference.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIR-192-Reporter was a gift from Mien-Chie Hung (Addgene plasmid # 71872 ; http://n2t.net/addgene:71872 ; RRID:Addgene_71872)
  • For your References section:

    EGFR modulates microRNA maturation in response to hypoxia through phosphorylation of AGO2. Shen J, Xia W, Khotskaya YB, Huo L, Nakanishi K, Lim SO, Du Y, Wang Y, Chang WC, Chen CH, Hsu JL, Wu Y, Lam YC, James BP, Liu X, Liu CG, Patel DJ, Hung MC. Nature. 2013 May 16;497(7449):383-7. doi: 10.1038/nature12080. Epub 2013 May 1. 10.1038/nature12080 PubMed 23636329