pMIR-193a-5p-Reporter
(Plasmid
#71873)
-
PurposeMammalian expression vector for the analysis of miR-193a-5p activity
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMIR-REPORT Luciferase
-
Backbone manufacturerApplied Biosystems
- Backbone size w/o insert (bp) 6470
- Total vector size (bp) 6498
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReverse complementary sequence of miR-193a-5p
-
Alt namemiR-193a-5p binding sequence
-
gRNA/shRNA sequenceTTGGGTCTTTGCGGGCGAGATGAA
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- firefly luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer Luc-F
- 3′ sequencing primer pRS-marker
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Human miR-193a-5p binding site was generated by annealing of two oligos as described in the reference.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIR-193a-5p-Reporter was a gift from Mien-Chie Hung (Addgene plasmid # 71873 ; http://n2t.net/addgene:71873 ; RRID:Addgene_71873) -
For your References section:
EGFR modulates microRNA maturation in response to hypoxia through phosphorylation of AGO2. Shen J, Xia W, Khotskaya YB, Huo L, Nakanishi K, Lim SO, Du Y, Wang Y, Chang WC, Chen CH, Hsu JL, Wu Y, Lam YC, James BP, Liu X, Liu CG, Patel DJ, Hung MC. Nature. 2013 May 16;497(7449):383-7. doi: 10.1038/nature12080. Epub 2013 May 1. 10.1038/nature12080 PubMed 23636329