Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAC1393-pmax-NLSPUFa_p65HSF1
(Plasmid #71897)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71897 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PUFa_p65HSF1
  • Species
    Synthetic
  • Promoter CAGGS + chim intron
  • Tag / Fusion Protein
    • p65HSF1 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gggcttgtcgagacagagaagat
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC1393-pmax-NLSPUFa_p65HSF1 was a gift from Albert Cheng (Addgene plasmid # 71897 ; http://n2t.net/addgene:71897 ; RRID:Addgene_71897)
  • For your References section:

    Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cheng AW, Jillette N, Lee P, Plaskon D, Fujiwara Y, Wang W, Taghbalout A, Wang H. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. 10.1038/cr.2016.3 PubMed 26768771