pAC1417-pmax-4xNLS_PUFa_2xNLS_mCBPHAT
(Plasmid
#71914)
-
Purpose4xNLS_PUFa_2xNLS_mCBPHAT in pmax expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAC90-pmax-DEST
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name4xNLS_PUFa_2xNLS_mCBPHAT
-
SpeciesSynthetic
- Promoter CAGGS + chim intron
-
Tag
/ Fusion Protein
- mCBP HAT domain (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gggcttgtcgagacagagaagat
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit http://casil.io for more information, updates, and protocols.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC1417-pmax-4xNLS_PUFa_2xNLS_mCBPHAT was a gift from Albert Cheng (Addgene plasmid # 71914) -
For your References section:
Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cheng AW, Jillette N, Lee P, Plaskon D, Fujiwara Y, Wang W, Taghbalout A, Wang H. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. 10.1038/cr.2016.3 PubMed 26768771