Skip to main content

pAC1420-pX-sgRNA-1xPBSa
(Plasmid #71917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71917 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330; pUC ori vector
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter U6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gagggcctatttcccatgattcc
  • 3′ sequencing primer gccatttgtctgcagaattggc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit http://casil.io for more information, updates, and protocols.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC1420-pX-sgRNA-1xPBSa was a gift from Albert Cheng (Addgene plasmid # 71917)
  • For your References section:

    Casilio: a versatile CRISPR-Cas9-Pumilio hybrid for gene regulation and genomic labeling. Cheng AW, Jillette N, Lee P, Plaskon D, Fujiwara Y, Wang W, Taghbalout A, Wang H. Cell Res. 2016 Feb;26(2):254-7. doi: 10.1038/cr.2016.3. Epub 2016 Jan 15. 10.1038/cr.2016.3 PubMed 26768771