pCDH-CB-IRES-copGFP-T2A-Puro
(Plasmid #72299)

• Purpose: (Empty Backbone) Express gene of interest under CB promoter
• Depositing Lab: Kazuhiro Oka
• Publication: pCDH-CB-IRES-copGFP-T2A-Puro (unpublished)

Backbone

• Vector backbone: pCDH-CMV-MCS
  (Search Vector Database)
• Backbone manufacturer: Systembio
• Backbone size (bp): 6677
• Modifications to backbone: ClaI/SalI fragment was replaced with CB promoter + MCS
• Vector type: Mammalian Expression, Lentiviral
• Promoter: chicken beta-actin + CMV enhancer
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CGGTGGTGGTGCAAATCAAA
• 3′ sequencing primer: CAACACCACGGAATTGTCAG

Resource Information

• Supplemental Documents:
  • pCDH-CB-IRES-copGFP-T2A-Puro
  • Lenti-Transfection (2nd generation)-2016
  • Plasmid_Addgene-2016-BCM_GVC_Oka

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Institut Pasteur Label License for cPPT
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor noted that the single nucleotide mismatch (G>A, bp 3249) within IRES found in Addgene's quality control sequence does NOT affect plasmid function.