Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

hEBI3 pEF6-V5 (MJS_002)
(Plasmid #72490)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72490 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF6/V5-His
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5840
  • Total vector size (bp) 6531
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EBI3
  • Alt name
    IL-27B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    691
  • Entrez Gene
    EBI3 (a.k.a. IL-27B, IL27B)
  • Promoter EF-1 alpha
  • Tag / Fusion Protein
    • His/V5 (C terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hEBI3 pEF6-V5 (MJS_002) was a gift from Matthew Sweet (Addgene plasmid # 72490 ; http://n2t.net/addgene:72490 ; RRID:Addgene_72490)
  • For your References section:

    TLR3 drives IRF6-dependent IL-23p19 expression and p19/EBI3 heterodimer formation in keratinocytes. Ramnath D, Tunny K, Hohenhaus DM, Pitts CM, Bergot AS, Hogarth PM, Hamilton JA, Kapetanovic R, Sturm RA, Scholz GM, Sweet MJ. Immunol Cell Biol. 2015 Oct;93(9):771-9. doi: 10.1038/icb.2015.77. Epub 2015 Aug 25. 10.1038/icb.2015.77 PubMed 26303210