Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #72573)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72573 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone size w/o insert (bp) 5307
  • Total vector size (bp) 6555
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Mutation
    5 silent mutations around shRNA recognition sequence
  • GenBank ID
  • Entrez Gene
    Pick1 (a.k.a. Prkcabp)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtgacactatagaataacatccac
  • 3′ sequencing primer cccgatcgatccagacatgataag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK5-myc-PICK1-rescue was a gift from Victor Anggono & Richard Huganir (Addgene plasmid # 72573 ; ; RRID:Addgene_72573)
  • For your References section:

    PICK1 loss of function occludes homeostatic synaptic scaling. Anggono V, Clem RL, Huganir RL. J Neurosci. 2011 Feb 9;31(6):2188-96. doi: 10.1523/JNEUROSCI.5633-10.2011. 10.1523/JNEUROSCI.5633-10.2011 PubMed 21307255