pJB051 (mEos2-ZapA)
(Plasmid
#72650)
-
PurposeInducible expression of mEos2-ZapA in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCA24N
-
Backbone manufacturerNBRP-E.coli at NIG
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5500
-
Modifications to backbonereplaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor fluorescence studies, grow at RT or 30C.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEos2-ZapA
-
SpeciesE. coli
-
Insert Size (bp)1040
- Promoter T5-lac
-
Tag
/ Fusion Protein
- mEos2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCGTAATAGCGAAGAGGCCCG
- 3′ sequencing primer cattactggatctatcaacaggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB051 (mEos2-ZapA) was a gift from Jie Xiao (Addgene plasmid # 72650 ; http://n2t.net/addgene:72650 ; RRID:Addgene_72650) -
For your References section:
A multi-layered protein network stabilizes the Escherichia coli FtsZ-ring and modulates constriction dynamics. Buss J, Coltharp C, Shtengel G, Yang X, Hess H, Xiao J. PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr. PGENETICS-D-14-03238 [pii] PubMed 25848771