Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXY029 (mEos2-MTSBs)
(Plasmid #72652)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72652 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCA24N
  • Backbone manufacturer
    NBRP-E.coli at NIG
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5200
  • Modifications to backbone
    replaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For fluorescence studies, grow at RT or 30C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEos2-MTSBs
  • Alt name
    MTSBs: membrane targeting sequence of MinD from Bacillus subtilis
  • Species
    B. subtilis
  • Insert Size (bp)
    743
  • Promoter T5-lac
  • Tag / Fusion Protein
    • mEos2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCGTAATAGCGAAGAGGCCCG
  • 3′ sequencing primer cattactggatctatcaacaggag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXY029 (mEos2-MTSBs) was a gift from Jie Xiao (Addgene plasmid # 72652 ; http://n2t.net/addgene:72652 ; RRID:Addgene_72652)
  • For your References section:

    A multi-layered protein network stabilizes the Escherichia coli FtsZ-ring and modulates constriction dynamics. Buss J, Coltharp C, Shtengel G, Yang X, Hess H, Xiao J. PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr. PGENETICS-D-14-03238 [pii] PubMed 25848771