Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FCIV1-GR SS287AA/S155A
(Plasmid #72700)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72700 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCIV1
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GR
  • Alt name
    NR3C1
  • Alt name
    nuclear receptor subfamily 3, group C, member 1
  • Species
    R. norvegicus (rat)
  • Mutation
    SS287AA/S155A
  • Promoter ubiquitin
  • Tag / Fusion Protein
    • IRES-Venus (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer FCIV1-5 (gttagacgaagcttgggctgcaggtcgac)
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCIV1-GR SS287AA/S155A was a gift from Freddy Jeanneteau (Addgene plasmid # 72700 ; http://n2t.net/addgene:72700 ; RRID:Addgene_72700)
  • For your References section:

    Brain-derived neurotrophic factor signaling rewrites the glucocorticoid transcriptome via glucocorticoid receptor phosphorylation. Lambert WM, Xu CF, Neubert TA, Chao MV, Garabedian MJ, Jeanneteau FD. Mol Cell Biol. 2013 Sep;33(18):3700-14. doi: 10.1128/MCB.00150-13. Epub 2013 Jul 22. 10.1128/MCB.00150-13 PubMed 23878391