Skip to main content
Addgene
Open Menu

AAVS1 T2 CRIPR in pX330
(Plasmid #72833)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72833 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 72833-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 72833-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pX330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 and gRNA for targeting the AAVS1 locus in human cells
  • gRNA/shRNA sequence
    GGGGCCACTAGGGACAGGAT
  • Species
    H. sapiens (human)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer aggctgttagagagataattgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is based on pX330-U6-Chimeric_BB-CBh-hSpCas9 from Dr. Feng Zhang (Addgene #42230)(Cong et al, Science, 2013). The AAVS1 target sequence is described in Mali et al (Mali et al, Science, 2013).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1 T2 CRIPR in pX330 was a gift from Masato Kanemaki (Addgene plasmid # 72833 ; http://n2t.net/addgene:72833 ; RRID:Addgene_72833)

  • For your References section:

    Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Natsume T, Kiyomitsu T, Saga Y, Kanemaki MT. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24. 10.1016/j.celrep.2016.03.001 PubMed 27052166

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More
Related items:
Commonly requested with: