pHR-FKBP:mCherry-KRas4Bc30
(Plasmid
#72900)
-
PurposeMembrane-targeted mCherry-tagged recruiter construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR'
- Total vector size (bp) 10112
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGTPase K-Ras
-
Alt nameKRas4B (isoform 2B)
-
SpeciesH. sapiens (human)
-
Mutationamino acids 158..188 (fragment 1..157 deleted)
-
GenBank IDNM_004985.4
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
-
Tags
/ Fusion Proteins
- FKBP (N terminal on insert)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gcttcccgagctctataaaagagc
- 3′ sequencing primer ccagaggttgattatcgataagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-FKBP:mCherry-KRas4Bc30 was a gift from Ivan Yudushkin (Addgene plasmid # 72900 ; http://n2t.net/addgene:72900 ; RRID:Addgene_72900) -
For your References section:
Localization of mTORC2 activity inside cells. Ebner M, Sinkovics B, Szczygiel M, Ribeiro DW, Yudushkin I. J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060. 10.1083/jcb.201610060 PubMed 28143890