Skip to main content
Addgene

N1-mSin1.2-GFP
(Plasmid #72908)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72908 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N1
  • Total vector size (bp) 6182
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Target of rapamycin complex 2 subunit MAPKAP1, isoform 2
  • Alt name
    mSin1.2
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer cctctacaaatgtggtatggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N1-mSin1.2-GFP was a gift from Ivan Yudushkin (Addgene plasmid # 72908 ; http://n2t.net/addgene:72908 ; RRID:Addgene_72908)
  • For your References section:

    Localization of mTORC2 activity inside cells. Ebner M, Sinkovics B, Szczygiel M, Ribeiro DW, Yudushkin I. J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060. 10.1083/jcb.201610060 PubMed 28143890