N1-mSin1.2-GFP
(Plasmid
#72908)
-
PurposeGFP-tagged mSin1 (isoform 2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN1
- Total vector size (bp) 6182
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTarget of rapamycin complex 2 subunit MAPKAP1, isoform 2
-
Alt namemSin1.2
-
SpeciesH. sapiens (human)
-
Entrez GeneMAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer cctctacaaatgtggtatggc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N1-mSin1.2-GFP was a gift from Ivan Yudushkin (Addgene plasmid # 72908 ; http://n2t.net/addgene:72908 ; RRID:Addgene_72908) -
For your References section:
Localization of mTORC2 activity inside cells. Ebner M, Sinkovics B, Szczygiel M, Ribeiro DW, Yudushkin I. J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060. 10.1083/jcb.201610060 PubMed 28143890