Skip to main content
Addgene

Gg 1.8kb rhodopsin GFP
(Plasmid #72917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72917 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Modifications to backbone
    no basal GFP Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    chicken rhodopsin
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    1880
  • Entrez Gene
    RHO (a.k.a. CSNBAD1, OPN2, RDP1, RP4, opsin-2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGACTTAGTACCGGCAGAGG
  • 3′ sequencing primer TCAGCGTCGGTTTTTGTATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gg 1.8kb rhodopsin GFP was a gift from Joseph Corbo (Addgene plasmid # 72917 ; http://n2t.net/addgene:72917 ; RRID:Addgene_72917)
  • For your References section:

    Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106