Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLZRS-IRES-deltaNGFR
(Plasmid #72930)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72930 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLZRS-IRES-deltaNGFR
  • Backbone manufacturer
    Roel de Paus
  • Backbone size (bp) 12878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer gcccacgtgaaggctgccgacc
  • 3′ sequencing primer acgttaggggggggggagggagag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Extracellular domain of NGFR is expressed in tandem with the insert, thus allowing FACS selection of cells retrovirally expressing the insert.

Discrepancies between the full and QC sequence should not have any functional consequence.

This plasmid has been found to be somewhat unstable and prone to recombination. You may need to screen multiple colonies to isolate the full-length, monomeric version of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLZRS-IRES-deltaNGFR was a gift from Esther van de Vosse (Addgene plasmid # 72930 ; http://n2t.net/addgene:72930 ; RRID:Addgene_72930)
  • For your References section:

    Antisense-mediated exon skipping to correct IL-12Rbeta1 deficiency in T cells. van_de_Vosse E, Verhard EM, de Paus RA, Platenburg GJ, van Deutekom JC, Aartsma-Rus A, van Dissel JT. Blood. 2009 May 7;113(19):4548-55. doi: 10.1182/blood-2008-12-196220. Epub 2009 Mar 3. 10.1182/blood-2008-12-196220 PubMed 19258592