Skip to main content

pET21-Drp1(deltaIB)
(Plasmid #73041)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73041 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21b(+)
  • Backbone manufacturer
    EMD Millipore (Novagen)
  • Modifications to backbone
    PreScission protease site inserted via BamHI/HindIII sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Drp1(deltaIB)
  • Alt name
    Drp1dIB
  • Alt name
    Drp1 delta insert B
  • Alt name
    Drp1 514-602 deletion
  • Species
    M. musculus (mouse)
  • Mutation
    Deleted amino acids 514-602
  • GenBank ID
    NM_001025947.2
  • Entrez Gene
    Dnm1l (a.k.a. 6330417M19Rik, Dlp1, Dnmlp1, Drp1, python)
  • Promoter T7
  • Tags / Fusion Proteins
    • PreScission Protease site (C terminal on backbone)
    • 6xHis-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21-Drp1(deltaIB) was a gift from David Chan (Addgene plasmid # 73041 ; http://n2t.net/addgene:73041 ; RRID:Addgene_73041)
  • For your References section:

    The mitochondrial fission receptor Mff selectively recruits oligomerized Drp1. Liu R, Chan DC. Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7. 10.1091/mbc.E15-08-0591 PubMed 26446846