Skip to main content

pCR4_SNORD27 probe
(Plasmid #73069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73069 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR4-TOPO
  • Vector type
    in vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SNORD27
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    82
  • Entrez Gene
    SNORD2 (a.k.a. R39B, SNR39B)
  • Promoter t7

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer AACCACTCCATGATGAACA
  • 3′ sequencing primer CTCTCACTTCTCAGTAGTAAGATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR4_SNORD27 probe was a gift from Stefan Stamm (Addgene plasmid # 73069 ; http://n2t.net/addgene:73069 ; RRID:Addgene_73069)
  • For your References section:

    Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing. Falaleeva M, Pages A, Matuszek Z, Hidmi S, Agranat-Tamir L, Korotkov K, Nevo Y, Eyras E, Sperling R, Stamm S. Proc Natl Acad Sci U S A. 2016 Mar 22;113(12):E1625-34. doi: 10.1073/pnas.1519292113. Epub 2016 Mar 8. 10.1073/pnas.1519292113 PubMed 26957605