Synapsin sHRPb-NLG in FSW lentiviral vector
(Plasmid #73148)

• Purpose: Small fragment of split HRP fused to the extracellular terminus of NLG1. This is a lentiviral plasmid, but can also be used for transfections. Syanpsin promoter.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: FSW lentiviral vector
• Backbone size w/o insert (bp): 8451
• Total vector size (bp): 11337
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sHRPb-NLG
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 2886
• Entrez Gene: Nlgn1 (a.k.a. 6330415N05Rik, NL1, Nlg1, mKIAA1070)
• Promoter: Synapsin
• Tag / Fusion Protein:
  • V5 tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: CTCCCCTTCCCGGCCACCTTGGTCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPb is the small split HRP fragment. It consists of amino acids 214-308 of horseradish peroxidase (HRP) with the following 2 mutations: N255D, L299R.

The plasmid contains the following features (including promoter region):
PacI-SynapsinP-XbaI-NLG1 ss-AgeI-sHRPb-5 aa linker-V5 epitope tag-MfeI-NLG1-stop-AscI

Human synapsin promoter
5 aa linker: GSGSG
V5 epitope tag: GKPIPNPLLGLDST
Lentiviral vector. Derived from FCGW with human synapsin1 promoter replacing CMV