mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
(Plasmid
#73269)
-
PurposemHDAC7-U (23-938) pEF6-V5 (MJS_017) (Flag tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEF6/V5-His
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5840
- Total vector size (bp) 8535
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHDAC7
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2752
-
GenBank IDNM_001204278.1
-
Entrez GeneHdac7 (a.k.a. 5830434K02Rik, HD7, HD7a, Hdac7a, mFLJ00062)
-
Tag
/ Fusion Protein
- Flag (C terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018) was a gift from Matthew Sweet (Addgene plasmid # 73269 ; http://n2t.net/addgene:73269 ; RRID:Addgene_73269) -
For your References section:
Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages. Shakespear MR, Hohenhaus DM, Kelly GM, Kamal NA, Gupta P, Labzin LI, Schroder K, Garceau V, Barbero S, Iyer A, Hume DA, Reid RC, Irvine KM, Fairlie DP, Sweet MJ. J Biol Chem. 2013 Aug 30;288(35):25362-74. doi: 10.1074/jbc.M113.496281. Epub 2013 Jul 12. 10.1074/jbc.M113.496281 PubMed 23853092