CpcB•PHLS+Cpc
(Plasmid
#73335)
-
PurposeExpresses the PHLS gene as a fusion with the CpcB gene followed by the CmR gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73335 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2877
- Total vector size (bp) 6991
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecpcB•PHLS-CmR
-
SpeciesSynechocystis PCC 6803
-
Insert Size (bp)2960
- Promoter cpc operon
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer TCGAGaagagtccctgaatatc
- 3′ sequencing primer gccatcaatgctctgagctag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CpcB•PHLS+Cpc was a gift from Anastasios Melis (Addgene plasmid # 73335 ; http://n2t.net/addgene:73335 ; RRID:Addgene_73335) -
For your References section:
A phycocyanin.phellandrene synthase fusion enhances recombinant protein expression and beta-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria). Formighieri C, Melis A. Metab Eng. 2015 Nov;32:116-24. doi: 10.1016/j.ymben.2015.09.010. Epub 2015 Sep 26. 10.1016/j.ymben.2015.09.010 PubMed 26410450