pLenti-CMV-mOC-STAMP (N162D)-GFP
(Plasmid
#73580)
-
PurposeLentivirus expression of mOC-STAMP with N162D mutation
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-CMV-MCS-GFP-SV-puro
- Backbone size w/o insert (bp) 8437
- Total vector size (bp) 9934
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOC-STAMP
-
SpeciesM. musculus (mouse)
-
Mutationchanged asparagin (N) 162 to Aspartic Acid (D)
-
Entrez GeneOcstamp (a.k.a. 4833422F24Rik, OC-STAMP)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (unknown if destroyed)
- 3′ cloning site Xba1 (unknown if destroyed)
- 5′ sequencing primer tcttaggcaatgtgcgtgcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-mOC-STAMP (N162D)-GFP was a gift from Paul Odgren (Addgene plasmid # 73580 ; http://n2t.net/addgene:73580 ; RRID:Addgene_73580) -
For your References section:
Studies of OC-STAMP in Osteoclast Fusion: A New Knockout Mouse Model, Rescue of Cell Fusion, and Transmembrane Topology. Witwicka H, Hwang SY, Reyes-Gutierrez P, Jia H, Odgren PE, Donahue LR, Birnbaum MJ, Odgren PR. PLoS One. 2015 Jun 4;10(6):e0128275. doi: 10.1371/journal.pone.0128275. eCollection 2015. PONE-D-14-50827 [pii] PubMed 26042409