p415 CHI-8
(Plasmid
#73870)
-
PurposeChimaera 8 (COPD-Ret2)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep415
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChimaera 8
-
SpeciesB. taurus (bovine), S. cerevisiae (budding yeast)
- Promoter Met25
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CTTTTTCTTGCTCTCTTGTCTTTTCATCTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p415 CHI-8 was a gift from Blanche Schwappach (Addgene plasmid # 73870) -
For your References section:
delta-COP contains a helix C-terminal to its longin domain key to COPI dynamics and function. Arakel EC, Richter KP, Clancy A, Schwappach B. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6916-21. doi: 10.1073/pnas.1603544113. Epub 2016 Jun 13. 10.1073/pnas.1603544113 PubMed 27298352